Handbook

Specimen Data Submission Protocol

Specimen Data submissions are the first step in the process of creating records on BOLD and have to be submitted before images, traces, and sequences can be uploaded. Once the Specimen Data is uploaded, records are created and BOLD Process IDs are automatically assigned to each sample. Sample IDs can be used to upload images, trace files, and sequences. There are two methods for creating new specimen records on BOLD; 1) Batch Format - which uses a spreadsheet template for uploading large numbers of records, or 2) Single Specimen Format - using an online form.

In this section: Batch Specimen Submissions Example Spreadsheet for batch new submission Single Specimen Submissions Definition of Specimen Data Fields Updating Specimen Data

Batch Specimen Submissions

A batch submission of new specimen data records to BOLD through the BOLD Data Managers is the most efficient way to upload specimen records for those working with large number of samples , including 96-well plates. There are two major steps involved in this process: creating the excel file and submitting the file for validation and upload to BOLD.

1. Create Excel file submission
   • New submissions are project specific so that the data can be associated with a project on BOLD. If samples need to be submitted to multiple projects, a separate excel file for each project needs to be created:
     • Template Version 3.0
       A spreadsheet submission template containing all the original and extended data fields
   • The template consists of 4 worksheets; a main specimen identifier worksheet (voucher info) as well as worksheets for taxonomy, specimen details, and collection data. Minimal information can be submitted to start, and records can be updated at a later date following the Update Specimen Data Protocol.
   • The minimum required data to complete a new specimen record on BOLD are:
     • Sample ID
     • Field ID and/or Museum voucher ID
     • Institution Storing
     • Phylum
     • Country
2. Submit file to BOLD for processing
   1. Open the destination project on BOLD
   2. Click on Specimen Data under the Uploads menu and select Initiate Batch Submission . This option is available to Project Managers and project users with Edit Specimen access.
   3. Select New for the submission type.
   4. In the form users will need to attach the Excel template they want to submit to the project. Users can also include email addresses for collaborators that should be cc'd on further communications regarding the submission, add a note about the submission, and check off the high priority box, if the submission should be processed with urgency. Once the form is completed, users then click on Submit to send the spreadsheet for the first pass of validation.
   5. If there are any errors detected during this validation, users will need to resolve these re-submit the spreadsheet.

Upon a successful submission of the package, an email confirmation will be sent out with a trackable ticket number. The uploaded data will be processed by our data submission staff who will be in contact with the submitter if any queries regarding the submitted data arise. Data is usually incorporated into the database within 1 to 2 business days as long as there are no issues.

For any questions or concerns about the process of submitting or creating new specimen records in batch, please email the Data Management Team through [email protected].

Example Batch Submission for Specimen Data Records

BOLD supports the upload of multiple specimen records in a spreadsheet format:

• Template Version 3.0
  A spreadsheet submission template containing all the original and extended data fields

Below is an example of a properly filled out data submission for Template Version 3.0. Use the tabs at the bottom of the Excel workbook to navigate through the four pages.

Example data for Voucher (Specimen) Info Worksheet

Specimen Info
Sample ID	Field ID	Museum ID	Collection Code	Institution Storing
Sample-demo01	Sample-demo01			Burke Museum
Sample-demo02	Sample-demo02	15466	ISC	Burke Museum
Sample-demo03	15332-988a			Burke Museum

Example data for Taxonomy Worksheet

Taxonomy
Sample ID	Phylum	Class	Order	Family	Subfamily	Genus	Species	Identifier	Identifier Email	Identifier Institution	Identification Method	Taxonomy Notes
Sample-demo01	Arthropoda	Insecta	Diptera	Asilidae	Hydro- psychinae	Efferia	Efferia aestuans	Jose Lopez	jgonzales @bio.org	Biodiversity Institute	morpho- logical	High Confidence in identification
Sample-demo02	Arthropoda	Insecta	Diptera	Asilidae	Dasypo- goninae	Leptarthrus	Leptarthrus brevirostris	Jose Lopez	jgonzales @bio.org	Biodiversity Institute	morpho- logical	High Confidence in identification
Sample-demo03	Arthropoda	Insecta	Diptera	Asilidae	Dasypo- goninae	Wilcoxia		Jose Lopez	jgonzales @bio.org	Biodiversity Institute	morpho- logical	Not sure on genus, possible new genus

Example data for Specimen Details Worksheet

Specimen Details
Sample ID	Sex	Reproduction	Life Stage	Extra Info	Notes	Voucher Status	Tissue Descriptor	Associated Taxa	Associated Specimens	External URLs
Sample-demo01	Male	Sexual	Adult	Region 1		vouchered: registered collection	leg
Sample-demo02	Female	Sexual	Adult	Region 1		vouchered: registered collection	leg			www.burke.edu /spec/15466
Sample-demo03		Sexual	Larvae		collected with predator	vouchered: registered collection		predator: Hornet	predator: BITK002-12

Example data for Collection Info Worksheet Part 1

Collection Info
Sample ID	Collectors	Collection Date	Country/Ocean	State/ Province	Region	Sector	Exact Site	Latitude	Longitude	Elevation	...
Sample-demo01	J. Lopez, M. Lopez	27-JUL-10	Canada	Ontario	Wellington County	Guelph	Kortright Preservation Park	43.511	-80.223	300 m
Sample-demo02	J. Lopez, M. Lopez	27-JUL-10	Canada	Ontario	Wellington County	Guelph	Kortright Preservation Park	43.511	-80.223	300 m
Sample-demo03	Erica Langley	15-AUG-11	United States	Texas	Jeff Davis County	Davis Mountains State Park	South camping area	30.607	-103.934	1475 m

Example data for Collection Info Part 2

Collection Info
...	Depth	Elevation Precision	Depth Precision	GPS Source	Coordinate Accuracy	Event Time	Collection Date Accuracy	Habitat	Sampling Protocol	Collection Notes	Site Code	Collection Event ID
		2 m			1 m	mid summer	2	dry forest	Malaise	Trap at park entrance near Kortright Rd.	#14	#M872a
		2 m			1 m	mid summer	2	dry forest	Malaise	Trap at park entrance near Kortright Rd.	#14	#M872a
		10 m		garmin unit		morning		hydric- mesic	hand picked	next to Limpia Creek		15332-988

 

Single Specimen Submission

Users may also choose to add single records manually to the system through the Specimen Data Upload option available in the Project Console. This is the fastest way to add an individual record to a project and is recommended for uploads of 10 records or less. This option is available to project managers and project users with access to edit specimen data. There are two steps involved in this process:

1. Navigate to record submission form for Specimen Data
   1. Open the destination project on BOLD
   2. Click on Specimen Data under the Uploads menu to access the Specimen Data Submission form.
2. Fill in Specimen Data and Submit

The minimum required data to complete a new specimen record on BOLD are:

• Sample ID
• Field ID and/or Museum voucher ID
• Institution Storing
• Phylum
• Country

Records can be updated at a later date following the Update Specimen Data Protocol.

Single record submission form

Definition of Specimen Data Fields

Field definitions for Voucher (Specimen) info page (* denotes required fields for a record)

Sample ID*	Identifier for the sample being sequenced, often identical to the Field ID or Museum ID.  Sample identifiers are extended when tissue is sub-sampled for secondary analysis. It is important to use a unique and original format for the Sample IDs. If the Sample IDs provided are not original to BOLD, they will need to be changed before the data can go online. Only the following characters may be used in the Sample ID, Field ID, and Museum ID: A-Z 0-9 ^ . : - _ ( ) # . All other characters will be removed.
Field ID*	Identifier for specimen assigned in the field.  Specimens in personal collections will continue to use this as the primary identifier for the specimen. (Either Field ID or the Museum ID must be filled in)
Museum ID*	Identifier for specimen assigned by formal collection upon accessioning, also referred to as the catalog number.  This identifier should be made unique by adding scope of the collection or institution.  This is done by following a triplet format Institution acronym:collection code:catalog number in the case of a museum collection and Personal:Name of collector:FieldID , in the case of a personal collection. (Either Field ID or the Museum ID must be filled in)
Collection Code	Code associated with a given collection within an institution. The Collection Code is used in conjunction with Museum ID in order to disambiguate a ID that might be used in different collections within the same institution. This field is only to be used if Museum ID field is used.
Institution Storing*	The full name of the institution that has physical possession of the voucher specimen. If the voucher is held in a personal research collection, users should enter the personal name.

Field definitions for Taxonomy Page (* denotes required fields for a record)

Full Taxonomy*	Full scientific name for each rank, consisting of phylum *, class, order, family, subfamily (optional), genus, and species. Interim names may be used up to family level. Interim names should contain non-Linnean characters such as numbers, punctuation and/or extra capitalization. Taxonomists are encouraged to append interim names with initials. (example: Bos sp. 1KHR)
Identifier	Full name of primary individual who assigned the specimen to a taxonomic group.
Identifier Email	E-mail address of the primary identifier. In the case where the identifier is deceased or retired, please make note of that in the email field. It is important to provide this information so we can keep the database up-to-date.
Identifier Institution	The full name of the identifier's institutional or organizational affiliation if one exists.
Identification Method	The method used to identify the specimen. (e.g.: BOLD ID Engine, morphology, field guide)
Tax Notes	Additional notes relating to the identification of the organism.

Field Definitions for the Specimen Details Page

Sex	The sex of the specimen. BOLD supports: "female", "hermaphrodite", or "male".
Reproduction	The presumed method of reproduction. BOLD supports: "sexual", "asexual", or "cyclic parthenogenesis".
Life Stage	The age class or life stage of the specimen at the time of sampling. "Adult", "Immature", "pupa", etc.
Extra Info	A brief note or project term associated with the specimen for rapid analysis. (max: 50 characters). This field will appear on the Record List and can be included in the Taxon ID tree
Notes	General notes regarding the specimen.
Voucher Status	Status of the specimen in an accessioning process. Controlled vocabulary: “museum vouchered:type” for type specimens “museum vouchered:type series” for specimens in a type series “vouchered:registered collection” for specimens that are vouchered in formal collection “to be vouchered:holdup/private” for specimens that are not yet vouchered but will be in the future “e-vouchered:dna/tissue+photo” for cases where the specimen has either been lost or consumed in the analytical process but was photographed prior to loss. “dna/tissue vouchered only” for cases where only only DNA or tissue samples remain “no specimen” for cases where all supporting tissue, DNA, or multimedia is missing or unavailable
Tissue Descriptor	A brief description of the type of tissue or material analyzed. Example: "muscle", "leg", "thorax", "liver", "blood", "feces", etc.
Associated Taxa	A list of taxa associated with the taxon at the time of its collection. References to taxa should be preceded by the relationship. Examples: "host: Quercus alba", "prey: caterpillar".
Associated Specimens	A list of specimens associated with the subject specimen at the time of its collection. References to other specimen identifiers should be preceded by the relationship. Examples: "host: PLANT23452, prey: USNM45677" when both prey and host specimens have been captured.
External URLs	Web accessible links that provide additional information about the specimen preceded by a descriptor.  Multiple links should be pipe separated ("|"). Example:  "specimen:http://www.antweb.org/specimen.do?name=casent0179894."

Field Definitions for Collection Data (* denotes required fields for a record)

Collectors	The full or abbreviated names of the individuals or team responsible for collecting the sample in the field.  Multiple individuals or teams should be separated by a comma.
Collection Event ID	A optional event ID for submission purposes that allows for relational data support when multiple specimens are collected from a single site.
Collection Date	The date during which the sample was collected. Format (DD-MMM-YYYY) is recommended to disambiguate where possible.
Date Accuracy	A numerical representation of the precision of the Collection Date given in days and is represented as +/- the value.  The default value for this field is 0 days.
Event Time	The time or time of day during which the sample was collected. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).  Also supported are general terms for time of day: "morning", "afternoon", "evening", "night".
Country/Ocean*	The full, unabbreviated name of the country, major political unit, or ocean in which the organism was collected.
State/Province	The full, unabbreviated name of the state, province, territory, or prefecture (i.e., the next smallest political region below Country) in which the organism was collected.
Region	The full, unabbreviated name of the county, shire, municipality, or park (i.e., the next smallest political region below province/state) in which the organism was collected.
Sector	The full, unabbreviated name of the lake, conservation area or sector of park in which the organism was collected.
Exact Site	Additional text descriptions regarding the exact location of the collection site relative to a geographic or biologically relevant landmark.
Site Code	The name of the sampling location.  Appropriate when site based sampling is performed.
Habitat	A category or description of the habitat in which the event occurred.  Envo ontology terms are recommended.
Sampling Protocol	The name of, reference to, or description of the method or protocol used during an event.
Latitude	The geographic latitude (in decimal degrees) of the geographic center of a location.
Longitude	The geographic longitude (in decimal degrees) of the geographic center of a location.
Coordinate Accuracy	A decimal representation of the precision of the coordinates given in the decimalLatitude and decimalLongitude.  This field also supports precision in kilometers which requires the value to be followed by the "km" unit.
Coordinate Source	The source of the latitude and longitude measurements.
Elevation	Elevation of sampling site.  Measured in meters relative to sea level.  Negative values indicate a position below sea level.
Elevation Precision	A numerical representation of the precision of the elevation given in meters and is represented as +/- the elevation value.  This field is only appropriate when a value is entered for elevation.
Depth	For organisms collected beneath the surface of a water body.  Measured in meters below surface of water.
Depth Precision	A numerical representation of the precision of the depth given in meters and is represented as +/- the depth value.  This field is only appropriate when a value is entered for depth.
Collection Notes	Comments or notes about the collection event.

Updating Specimen Data

The most efficient way to update an individual record in a project is using the Edit button on the Specimen Page . However, to add new taxa, identifiers, countries, or state/provinces to BOLD, users will need to use the Batch Update described below.

A. Manual Update of a Single Record

To modify or update individual records within a project, project managers and project users with editing specimen access can do so, manually by selecting the Edit button found in the Specimen Record page.

B. Batch Update of Multiple Records

Use this protocol when multiple records need to be updated, or to add new taxa, identifiers, countries, or state/provinces to records that currently exist in the BOLD database.

1. Download and modify the records that need updates:
   1. Within BOLD, navigate to the Record List or use the Record Search function, and select which records need to updated.
   2. Click on Data Spreadsheets using the Downloads menu on the left side of the Record List.
   3. Select only which pages need to be updated and download the excel workbook: Voucher Info, Taxonomy, Specimen Details, and Collection Data.
   4. Make changes onto the downloaded sheets.
2. Submit file to BOLD for processing:
   1. Navigate back to the Project Console.
   2. Click on Specimen Data under the Uploads menu and select the Initiate Batch Submission button. This option is available to project managers and project users with editing specimen access.
   3. Select Update for the submission type.
   4. In the form users will need to attach the Excel template they want to submit. Users can also include email addresses for collaborators that should be cc'd on further communications regarding the submission, add a note about the submission, and check off the high priority box for submission which should be processed with urgency. Once the form is completed, users then click on Submit to send the spreadsheet for the first pass of validation.
   5. If there are any errors detected during this validation, users will need to resolve these re-submit the spreadsheet.
3. Upon a successful submission of the package, an email confirmation will be sent out with a tracktable ticket number. The uploaded data will be processed by our data submission staff who will be in contact with the submitter any queries regarding the submitted data arise. Data is usually incorporated into the database within 1 to 2 business days if there are no issues.

For any questions or concerns about adding or updating specimen data, please email the Data Management Team through [email protected].

Back to Top

Image Submission Protocol

Images should be uploaded to BOLD to complete a specimen record. Specimen images are critical in the validation process. Before uploading images, specimen data records must first be uploaded to a BOLD project - please view the Specimen Data Submission Protocol for details. The ability to upload images is available to project managers and project users with editing specimen access.

In this section: Submitting Images to BOLD and Field Definitions for Excel Spreadsheet Example of Image Spreadsheet Tips and Troubleshooting for Image Uploads Photography Guide

Submission of Images to BOLD

1. Collect Images
   • Group high-quality specimen images in .jpg format into a folder. BOLD accepts high resolution images of up to 20 megapixels, but only displays a greatly reduced thumbnail. The high resolution image is archived but will not be distributed without the submitter’s explicit consent. Please refer to the Photography Guide for details on picture orientation and quality.
2. Assemble Excel File for Image Submission
   • BOLD provides a template for image submissions below. This spreadsheet associates the image files with the records on BOLD as well as uploads additional data such as captions, measurements, licensing, and attribution. All the images must be accounted for in the spreadsheet to be uploaded. Additional images that are not referenced in the Excel file will be ignored. A maximum of 10 images may be uploaded per specimen. The submission spreadsheet must be named ImageData.xls and contain the columns described below. See Tips and Troubleshooting for details on how to retrieve BOLD Process IDs and Image File names.
   • The minimum data required for each image submitted to BOLD are:
     • Image File name
     • Original Specimen
     • View Metadata
     • Sample ID
     • License
     • License Year
     • License Holder Institution
     • License Contact Details
3. Zip Package of Images and Excel File
   • The two components (image files and spreadsheet) need to be placed in a single folder. Select all the images and the spreadsheet and compress them all into a single zipped file before submitting. The free tools listed below are available to provide this functionality, however most modern operating systems have built-in functionality for zipping:
     • WinZip: http://www.winzip.com
     • WinRar: http://www.rarsoft.com
     • MacZipIt: http://www.maczipit.com
   • BOLD will accept a maximum zipped file size of 190 MB. Please confirm the file size before moving to the submission step. If the file is too large break it into more than one upload, each with its own spreadsheet.
4. Submit file to BOLD
   1. Login to BOLD and click on Images in the Data Uploads section of the User Console .
   2. In the form, select the Zip file to submit, users can include a brief description if desired.
   3. Click on Submit. Do not close the pop-up window until the successful upload message is displayed. The images will be immediately uploaded to the records and available to view.

ImageData.xls
Please click here to download the BOLD image submission template

Field definitions for ImageData spreadsheet. (*Required Fields)

Image File*	Complete name, including extension, and identical to the image file. See Tips and Troubleshooting below for details on how to retrieve Image File names directly from a folder.
Original Specimen*	Enter yes if the image shows the actual specimen for this record. Enter no for a photograph of representative specimen of the same species, photograph of the collection site, etc.
View Metadata*	Standardized term to group images depicting a specific set of features of the organisms or related environment. Such as: Dorsal, Ventral, Lateral, etc.
Caption	Free text description of the subject with a max of 400 characters. Short descriptions are recommended, such as: part of organism photographed, life stage, sex, etc.
Measurement	Any single relevant measurement that was taken in metric units.
Measurement Type	Item or feature that was measured.
Sample ID*	Sample ID for record, must match Sample ID on BOLD.
Process ID	Process ID for record, must match Process ID on BOLD.
License Holder	The primary individual holder of the license. This is less critical when using creative commons licenses. (64 Characters)
License*	License for use of the image. Pick one of the following types (short-forms are accepted): Copyright (c) No Rights Reserved (nrr) CreativeCommons – Attribution (by) CreativeCommons – Attribution Share-Alike (by-sa) CreativeCommons – Attribution No Derivatives (by-nd) CreativeCommons – Attribution Non-Commercial (by-nc) CreativeCommons – Attribution Non-Commercial Share-Alike (by-nc-sa) CreativeCommons – Attribution Non-Commercial No Derivatives (by-nc-nd)
License Year*	The year of license declaration (not the year of submission to BOLD). (4 Characters)
License Holder Institution*	The primary license holder’s institutional or organizational affiliation. Decisions regarding use of material fall to the institution when the individual is unreachable or unresponsive. (300 Characters)
License Contact*	Contact information for the license holder. Can be an email address, mailing address, phone number, or all of the above. (128 Characters)
Photographer	The individual or team responsible for photographing and editing the media prior to submission. (128 Characters)

Example Image Submission Spreadsheet:

Image Submission Spreadsheet (ImageData.xls) completed with sample data.

Image File	Original Specimen	View Metadata	Caption	Measurement	Measurement Type	Sample ID	Process ID	...
ROM912-D.jpg	yes	Dorsal skull		15 mm	Skull length	ROM 10912	BM272-03
ROM912-L.jpg	yes	Lateral lower jaw		7 mm	jaw length	ROM 10912	BM273-03
ROM913-L2.jpg	yes	Lateral skull		15 mm	Skull length	ROM 10913	BM274-03
ROMsiteA4-CS.jpg	no	Collection Site	Tide Pool Habitat			ROM 10913	BM274-03
ROM919-D2.jpg	no	Dorsal	representative Specimen	17 mm	Skull length	ROM 10914	BM275-03

.....	License Holder	License	License Year	License Institution	License Contact	Photographer
	Joe Smith	CreativeCommons – Attribution Non-Commercial Share-Alike	2010	Biodiversity Institute of Ontario	[email protected]	Joe Smith
	Sarah Johnson	CreativeCommons – Attribution Non-Commercial Share-Alike	2010	Biodiversity Institute of Ontario	[email protected]	Sarah Johnson
		CreativeCommons – Attribution Non-Commercial Share-Alike	2010	Biodiversity Institute of Ontario	[email protected]	BIO Photo Group
		CreativeCommons – Attribution Non-Commercial Share-Alike	2010	Biodiversity Institute of Ontario	[email protected]	BIO Photo Group
		CreativeCommons – Attribution Non-Commercial Share-Alike	2010	Biodiversity Institute of Ontario	[email protected]	BIO Photo Group

Image Submission - Tips and Troubleshooting

This section describes the most commonly encountered image upload problems.

• Zipped file must be under 190MB in size. If the upload fails to initialize, the zipped file may be too large. Break it into more than one upload, each with its own spreadsheet.
• Zipped file should not contain any sub folders - select the images and spreadsheet to zip, not the folder that contains them.
• The spreadsheet cannot contain any formulas.
• If the upload program cannot find the image files, it is possible that it cannot read the names. Make sure that the spreadsheet contains text values only.
• Full filenames must be used in excel sheet. The extension (.jpg) must be included in the image file name. The file extension is case sensitive (i.e., .JPG images will not be found in the zipped package if they are listed as .jpg in the spreadsheet).
• The spreadsheet must be named ImageData.xls. If the upload program cannot find the spreadsheet, confirm that it is named correctly (case sensitive).
• Verify the length of characters used in the free text fields and make adjustments if necessary.
• Data must start on the second line of the spreadsheet. There is only one line for the column headers.
• Adding extra columns to the sheet will cause errors.
• Image names cannot contain the characters "&" or "-". Please rename the images so that they do not have these characters.
• Images can not be uploaded to BOLD until the specimen data is uploaded.
• Only project managers and users with editing specimen access may upload images. If the user does not have permission to upload images, they must contact the project manager.

Users can upload more images in separate batches to any record at any time. To delete images for a record, please contact the BOLD Support Team through [email protected]. Notes that all images associated to a record will be deleted upon a request.

Photography Guide

This guide has been developed with assistance from the Canadian Centre for DNA Barcoding in an effort to provide best practices for taking voucher photographs. The BOLD database can accept up to ten images per specimen, so besides photos of a mounted or live organism, users can photograph and submit photos of distinguishing features or habitat.

To provide the best specimen image for viewing on the web, the following guidelines should be adhered:

• Please take pictures using the high quality mode on the camera, BOLD can accept photos up to 20MP.
• The specimen should be centered in the frame.
• Photos should be taken as close-up to the specimen as possible, leaving very little gap around the edges.
• It is often beneficial to include a measurement scale in the image to provide a size reference, or a colour scale to provide colour reference.
• Background should be a contrasting colour where possible
• Standardizing the aspect ratio during specimen photography will make images easier to compare
• Standardizing the position/orientation of each specimen will make it much easier to compare specimens across a project or BOLD. See below for common standardized orientations for animals, plants, and fungi.

Dorsal Oriented Images

• The anterior of the specimen should be facing the top of the image frame.
• The specimen should be face-down, with the dorsal aspect of the head visible

Lateral Oriented Images

• The anterior of the specimen should be facing the left side of the image frame.
• The specimen should be oriented with the feet towards the bottom of the image.

Ventral Oriented Images

• The anterior of the specimen should be facing the top of the image frame.
• The specimen should be face-up, with the ventral aspect of the head visible.

Herbarium Specimen Images

• The full sheet should be included in the frame
• The sheet should be oriented so that text is legible in photo

"Close Up" Images: Leaf, Fruit, Branch, Flower, Buds, Bark, Seeds, etc

• These are often live photographs with focus on distinguishing characteristics
• For plants, these may include opened fruit, adaxial veins, and male and female components.
• Macro focus is recommended, if available.

"Full Specimen" Images: Plant, Tree, In situ, etc

• These are often live photographs of the organism in its natural location.
• The specimen should be centered in the frame and provide information such as shape of plant, etc.
• If shooting outside, ideal environment has no wind and is slightly overcast (to avoid overexposure).

When entering a new orientation, capitalize only the first letter and do not add any words (e.g.: "view") to the end. If the specimen does not fit into any of these categories below, users may create a new category of view.

Larva Eggs Branch Flower Leaf Stem Habitat Collection Site Fruit Genitalia Wing Pupal Casing Blind Side Eyed Side Herbarium Specimen

Fruit Branch Flower Leaf Stem Buds Spines Inflorescence Infrutescence Bark Petiole Pollen Stem Roots Seeds Tree

Whole specimen Fruiting body Spores Spore print Microscopic Structures Colonies Stern Cap Gills Universal veil Volva Habitat Collection Site Sketch Illustration In situ

Back to Top

Trace Submission Protocol

Trace files are necessary for records to qualify for Barcode status and also to provide quality control for sequences. As well, BOLD can store failed or low quality traces that did not produce a quality sequence as part of an audit trail. This protocol assists in the submission of trace files consisting of electropherograms and optional Phred/score files to BOLD. It describes the necessary format of the files and the supporting data that is required for the correct submission. Before traces can be uploaded, specimen data records must first be uploaded to a BOLD project.

In this section: Submitting Traces to BOLD and Field Definitions for Excel Spreadsheet Example Spreadsheet for Trace Upload Tips and Troubleshooting for Trace Uploads Updating or Deleting Trace Files

Uploading Trace Files

1. Group Trace Files
   • Group trace files into a folder. Confirm that primers exist on BOLD by clicking on Primers under the Databases section of the BOLD header once signed in. If a primer isn't found, please view the Primer Registration Protocol for details on how to register a new primer in BOLD. Primer codes must match what is on BOLD exactly.
2. Assemble the Excel template for Trace Submission
   • Trace File Submission Template (data.xls)
     This spreadsheet associates the trace files with the records on BOLD as well as uploads ancillary data such as primers, direction, and marker. All the traces must be accounted for in the spreadsheet to be uploaded. Additional traces that are not referenced in the Excel file will be ignored. BOLD accepts a maximum of 10 traces per record.
   • The submission spreadsheet must be named data.xls and contains the columns described in the table below.
   • The minimal requirements on the Excel template are:
     • Trace File name
     • Forward and Reverse PCR Primers
     • Read Direction
     • Process ID
     • For a multimarker project, the marker must be filled in, otherwise traces will upload to the primary marker by default.
3. Zip Package of Traces and Excel File
   • The two components, consisting of trace files and the spreadsheet need to be placed in a single folder. Compress them all into a single zipped file before submission. The free tools listed below are available to provide this functionality, however, most modern operating systems have built-in functionality for zipping:
     • WinZip: http://www.winzip.com
     • WinRar: http://www.rarsoft.com
     • MacZipIt: http://www.maczipit.com
   • BOLD will accept a maximum zipped file size of 190 MB. Please confirm the file size before moving to Step IV. If the file is too large, break it into more than one upload, each with its own spreadsheet.
4. Submit file to Project
   1. Login to BOLD and click on Trace Files under the Data Uploads menu in the User Console. This option is available to project managers and project users with editing sequence access.
   2. In the form, select the Zip file to submit, and the run site for the analysis. Users can also include brief description if desired.
   3. Click on Submit. Do not close the pop-up window until the successful upload message is displayed. If phred scores are not included in the submission, BOLD will automatically calculate the quality values for the traces. Traces will not be viewable or downloadable from BOLD until the next business day.

Trace File Submission Template (data.xls)

Field definitions for accompanying spreadsheet. *Required Fields

Trace File*	Complete name, including extension (.ab1 or .scf) and identical to file name in the folder.
Score File	Complete name, including extension (.phd.1) and identical to file name in the folder, if available.
PCR Primers Fwd/Rev*	Primer codes are case sensitive. Both must be filled in.
Sequence Primer	Primer used in the sequencing process.
Read Direction*	Forward or Reverse.
Process ID*	Process ID of record, must match Process ID on BOLD.
Marker* (2 columns must be left blank after the Process ID column)	The marker needs to be filled in with the appropriate code: COI-5P ITS rbcL matK etc...

Example Submission Spreadsheet for Trace File Upload:

Trace File Submission Spreadsheet (data.xls) completed with sample data.

Trace File	Score file	PCR Fwd	PCR Rev	Seq Primer	Read Direction	Process ID	(blank)	(blank)	Marker
KKBNA001-04_H01.ab1	KKBNA001-04_H01.phd.1	BirdF1	BirdR1	BirdF1	Forward	KKBNA001-04			COI-5P
KKBNA001-04r_H07.ab1	KKBNA001-04r_H07.phd.1	BirdF1	BirdR1	BirdR1	Reverse	KKBNA001-04			COI-5P
KKBNA002-04_G01.ab1		BirdF1	BirdR1		Forward	KKBNA002-04			ITS
KKBNA002-04r_G07.ab1		BirdF1	BirdR1		Reverse	KKBNA002-04			ITS

Trace File Submission - Tips and Troubleshooting

• Primers must be registered before upload. If the primers are not registered, there will be an error. Please view the Primer Registration Protocol for more details.
• The zipped file must be under 190MB in size. If the upload fails to initialize, it is probably because the zipped file is too large. Try breaking it into more than one upload, each with its own spreadsheet.
• The spreadsheet cannot contain any formulas. If the upload program cannot find the files, it may be because it cannot read the names. Make sure to have text values only in the spreadsheet.
• Full filenames must be used in the excel template. The extension (.ab1, .scf, .phd.1) must be included in the file name. These extensions are case sensitive.
• The spreadsheet must be named data.xls. If the upload program can not find the excel sheet, confirm that it is named correctly (case sensitive).
• Data must start on the second line of the spreadsheet. There is only one line for the column headers.
• Do not add extra columns to the spreadsheet.
• If trace files appear under the wrong marker, or the marker name was entered improperly, then the program will not be able to read the marker column and will place the trace files by default under the primary marker in the project. To remove primers from the system, please forward the excel sheet to [email protected].
• Trace files will not be downloadable or viewable from BOLD until 24 hours after they have been submitted.
• Never rename .scf files as .ab1 files as this conversion will lose data from the trace files. BOLD supports both file types.
• Phred files (.phd.1) are not required for a trace upload. If Phred files are not uploaded, BOLD will calculate the Phred scores automatically.

Trace Updates or Deletions

• Users can upload more traces in separate batches to any record at any time.
• To update details on a trace file, if for example the wrong primers were uploaded, users can just re-upload the same trace file to the system with the corrected information in the spreadsheet.
• To delete any traces for a record, contact the BOLD Support Team through [email protected]

For any questions or concerns about trace submissions or management on BOLD, please email the Support Team through [email protected]

Back to Top

Sequence Submission Protocol

Before sequences can be uploaded to BOLD, specimen data records must be uploaded to a BOLD project. Sequences can be uploaded directly to BOLD for loci that have been registered in the BOLD’s marker database. New marker loci can be registered by emailing [email protected] with a description of the loci and an example GenBank accession. Upon upload of sequences, BOLD automatically compares the COI sequences against known contaminants (Human, Mouse, Cow, Pig, Wolbachia, etc.) and flags the record if there is a reasonable match. The upload event (person, activity, and timestamp) and the institution supporting the sequence editing are recorded in the audit trail to ensure proper attribution.

Sequence Uploads

1. Assemble FASTA formatted sequences
   • The sequence submission should consist of aligned sequences in FASTA format referenced by BOLD Process IDs or Sample IDs
     • To upload with Process IDs, obtain the Process IDs by clicking on Data Spreadsheets under the Downloads menu on the left side of a Project Console. Download the Progress Report to get the Process IDs that are assigned to each Sample ID.
     • The FASTA header line must conform to the following format: it should begin with a ‘>’, followed by the Process ID, followed by either a pipe (‘|’), an underscore (‘_’) or a space (‘ ’), followed by any other information that should be added. There can be no spaces before the end of the Process ID:
       • >"Process ID"|"Other Info"

         AGTCGACTAGCATCGATCGATCGTAGCTA...

     • To upload with Sample IDs, the FASTA header line must conform to the following format: it should begin with a ‘>’, followed by the Sample ID, followed by a pipe (‘|’), followed by any other information that should be added. For Sample ID uploads, an underscore (‘_’) or a space (‘ ’) is not allowed to divide the Sample ID from additional data in the header line.
       • >"Sample ID"|"Other Info"

         AGTCGACTAGCATCGATCGATCGTAGCTA...

2. Submit Sequences to BOLD
   1. Login to BOLD and click on Sequences under the Data Uploads menu in the User Console. This option is available to project managers and project users with editing sequence access.
   2. In the form, paste in the FASTA formatted sequences to submit to the project, BOLD will accept up to 1000 sequences in one upload, select the ID type, markers, and the run site for attribution. Only one type of sequence can be uploaded at a time. A brief description can also be included, if desired.
   3. Click on Submit. Do not close the pop-up window until the successful upload message is displayed. Sequences will be immediately uploaded to the records.

Sequence uploading form.

Field definitions for sequence upload window

Select ID:	Either Process ID or Sample ID may be used for upload.
Marker:	The marker (loci) of the sequences.
Run Site:	The lab that assembled and validated the sequences.
Paste sequences in FASTA format:	Example of Process ID upload: >TZBNA001-05|species name|region CTGCAGGANCAAAAAATGAAGTATTTAAATTTCGATCTGTTAATAATAACTAGCTACGCATGACA ATGCTCAGCAAAGCTGTAATTCCTACAGCTCAAACGAAAAGGGGTAGTTGATAAAATTAATTGCT CCTAAAATAGAAGAA >TZBNA002-05 CAGCTAATACGGGTAAAGATAATAATAATAAAAAAGCTGTAATTCCTACGATCGTACGCCAAAAAA TATATTATTTAAGCGTATATTAATAATAGTTGATGGCTAGGTATAATAAAATTGAAAAAATAGCTAAA TCTACAGAACTACCCCCATGGGCGATATTAGA >TZBNA012-05 AAAATAGCTAAATCAACTGAGCTTCCTCCATGAGCAATATTAGATGATGCTTCGATCTACAGC TCCATTTTCTACCACTCTTCTTGAAATTAAAAGAGTAATAGAAG

After sequences are uploaded, they are immediately viewable and downloadable on BOLD. Sequences are auto-checked during upload for stop codons and common contaminates. These are then recorded in the Project Console and flagged in the Record List.

Sequence Replacements and Deletions

• To edit a sequence on BOLD, navigate to the Sequence Page for the sample and select Edit Sequence. A text box will appear where changes can be made to the sequence.
• To replace a sequence on BOLD, simply upload a new sequence with the same Process ID or Sample ID.
• To delete a sequence on BOLD, use the "Delete" button that appears on the Sequence Page.

For any questions or issues regarding sequence submissions, please contact the BOLD Support Team through [email protected]

Back to Top

Primer Registration

Be sure that primers are registered with BOLD before assembling the submission package. View all public primers by clicking on Primers in the Databases section on the BOLD header. To register new primers, select Primers from the Data Uploads menu in the User Console.

Please note: If the primer sequence has already been registered under a different name, the already registered code will be provided to be used for trace submissions. On the primer registration form, fill in the information illustrated below.

BOLD Primer submission form

Field definitions for accompanying figure.

Primer Code*	Code for the primer, which should be between 3 and 12 characters. If the primer is already published in a manuscript, please use the code that is in press.
Primer Description	Description of what the primer should be used for.
Alias Code	Any other known code names for the primer, separated by commas.
Target Marker*	A list of registered markers (e.g. ITS, COI 5', matK).
Cocktail Primer	Allows for cocktail primers to be submitted.
Primer Sequence*	Fill in the sequence(s), 5' to 3'.
Direction*	The direction of the sequence.
Reference/Citation*	References and/or citations associated with the primer.
Notes	Notes about the primer.
Publicly Available	If the primer has already been published, this should be left public. The other option is the keep the primer private until publication.

 

Back to Top

Bibliography Submission

Users can add publication bibliographies to BOLD by using the Bibliography Submission Form available in three locations:

1. On the the User Console
2. Within a project, container, merged project(s), or dataset console
3. Within a Record List page (allows user to first select the records to populate the Primary Associated Records field.)

Users with editing sequence or editing specimen access to records will have the ability to submit a bibliography for records containing the GenBank accessions.

When an article is published, it is the project manager's responsibility to make the BOLD project or dataset public, so that the records and sequences are available to the public. To do this, project managers will need to click on Modify Project Properties within the Project Console and check off the box that says "Make this project publicly visible". Publications for associated records will be available from the Record Page on the Public Data Portal .

Bibliography Submission Form

Field definitions for accompanying form. (* indicates required fields)

Article Title*	The name of the article/publication.
Authors*	A list of the authors of the article, full names are recommended.
Journal*	The name of the journal that the article is published in.
Journal Details*	Year*, volume, issue, and page range.
DOI	Unique Digital Object Identifier.
PubMed Info	The PubMed ID (PMID) and PubMed Central ID (PMCID).
URL	The URL of the PDF version of the article from the journal’s site.
Open Access	Check box for openly accessible papers available without subscription.
Abstract*	Official abstract of the publication.
Dates*	Date published*, date received, date revised and date accepted.
Language	Language(s) the paper is written in, separated by a comma.
Keywords	List all keywords for the paper, separated by a comma.
Associated Records	The GenBank Accessions for the primary and secondary records. If the user submitting this bibliography does not have edit access to the primary records on BOLD, then they won’t be able to associate the records with the publication. Primary accessions are those that are first released with the publication, secondary accessions are previously public sequences used for reference in the publication.

 

Back to Top